Notes on PCR for determining recombination
5' end PCR
short constructs only (FCT, JBM)
B (1014) fwd CTGAGAAGCCACCCCTCACCCAGTTTTTCAACA
E (1017) rev GGGGCCCTCGACATAACTTCGTATAGCATACAT
lengths bp B
E 3824
3' end PCR
short and long constructs
F fwd acgagatcagcagcctctgttccacatacact
G fwd ctgactctagaggatctataacttcgtataatgtatgc
I rev tgtcagcaaaagtgtgctctgtctgccaagct
J rev gaagggatgactccagtctgtgtcagcaaaagtg
lengths bp F G
I 3055 2980
J 3075 3000
notes on 5' recombination and southern
digest BamHI
probe can use 1556 bp fragment NotI to BamHI of ki vector corresponding to start of left arm
allele length
+ 5954
TKO1 ki 1871
CK (ie. TKO1  
       to right of loxP1) 5954
FCT, JBM not needed, use PCR
S307A 4327
notes on 3' recombination and southern
digest KpnI
probe can use 497 bp fragment BamHI-HindIII of ki vector corresponding to start of right arm
allele length
+ 7478
all ki's 6009
notes on internal southern probe
digest BamHI
probe can use 1029 bp fragment BstBI to BamHI of ki vector from within Irs1 coding region
allele length
+ 5954
TKO1 ki ~4133
CK (ie. TKO1  
       to right of loxP1) 5954
FCT, JBM 5954
S307A 1628 (both ends of fragment are within coding region in this case)
notes on probe for Northerns (expected band is ~9.5kb)
can use BspE1 to BamHI fragment of Irs1 coding region=2565 bp (used as probe for rat, MFW)
can use XhoI fragment of ki vector from Irs1 coding region=3522 bp
can use short Xho1 fragment of ki vector including known Irs1 5' UTR=862 bp
notes on PCR across 3' intron notes on qPCR for IRS-1 (courtesy J Kushner)
primers for PCR across intron primers for qPCR
cdsN2 fwd GCAGTGAGGATGTAAAACGCCACAGCTCTGCATC 1qF fwd catggctccacttcagactgtct
cdsC2 fwd CAGCAATGAGGGCAACTCCCCAAGACGCTCCA 1qR rev ggactagaaccatactcatcagaagaga
3prev1 rev tgaaatagttcgagtctgggtacccatgag 1p (probe) fwd tcccgaggcgctctagtgcttcc
3prev2 rev caaaactgtaacggatgcatcgtaccatctac
3prev3 rev gaagtttatgcacactaattgttccggtgtcac lengths bp 1qF
1qR 107
product lengths + flox
cdsN2+ 3prev1 410 476 amplifies bp 1182 to 1288 of Irs1 ORF
  3prev2 477 543
  3prev3 586 652
cdsC2+ 3prev1 184 250
  3prev2 251 317
  3prev3 360 426