Today's date: |
9/19/05 |
|
|
|
|
|
|
|
|
|
|
PCR name: |
S7A |
|
Purpose: |
Distinguish between Irs1 S307A mutant (S7A) knockin and control
knockin (CK) alleles. Note: this is an allele-specific PCR; a wt (+) allele,
gives same bands as CK allele. Digest is not required. |
|
|
Samples: |
|
1 |
|
|
2 |
|
|
3 |
|
|
4 |
|
|
5 |
|
|
|
|
# of rxns |
|
Reactions (ul): |
X |
|
11 |
|
Profile name: |
JBM&S7A |
|
|
DNA |
1 |
|
|
|
step |
time (min:sec) |
temp (C) |
|
H20 |
11.5 |
|
126.5 |
|
1 |
15:00 |
95 |
|
10X buffer |
2 |
|
22 |
|
2 |
:30 |
94 |
|
4mM dNTPs |
1.5 |
|
16.5 |
|
3 |
:20 |
64 |
|
10pmol/ul primers |
|
4 |
:45 |
72 |
|
S7AF3 |
1 |
|
11 |
|
go to |
step 2 |
34 times |
|
NBR |
1 |
|
11 |
|
5 |
10:00 |
72 |
|
BF |
1 |
|
11 |
|
6 |
hold |
4 |
|
S7AR (1010) |
1 |
|
11 |
|
|
20 |
ul |
209 |
ul |
|
|
+ HotStar Taq |
0.18 |
ul |
1.98 |
|
|
|
Primers: |
Sequence: (5' to3') |
|
|
|
|
|
Tm |
|
|
S7AF3 |
GCAGCAAAAGCCAGTCTTCATCC |
|
59.0 |
|
NBR (not BamHI) |
AGGCACGCACCCGGAAGGAG |
|
64.9 |
|
BF (BamHI) |
AGTATGGTGGGTGGGAAACCAGGA |
|
61.9 |
|
S7AR (1010) |
CTGGGGTGACACTGCGGAAGG |
|
62.7 |
|
|
Products: |
from allele(s) |
length (bp) |
digests? |
|
primers |
|
|
|
|
common outer |
all alleles |
|
542 |
BamHI (S7A)* |
S7AF3 + S7AR |
|
spurious: |
all alleles (occasionally) |
~280 |
|
don't know origin of this band;
disregard |
|
S7A-specific (A) |
S7A |
|
399 |
|
BF + S7AR |
|
wt-specific (S) |
CK, +, etc |
|
185 |
|
S7AF3 + NBR |
|
|
|
(* from the S7A allele only, the common band from outer |
|
|
primers can be digested with BamHI) |
|
Genotypes: |
bands |
|
|
|
|
|
|
|
|
+/+ |
542 (variable), 185 |
|
CK/CK |
542 (variable), 185 |
|
S7A/CK or S7A/+ |
542 (variable), 399, 185 |
|
S7A/S7A |
542 (variable), 399 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|