| Today's date: | 9/19/05 | ||||||||||
| PCR name: | S7A | ||||||||||
| Purpose: | Distinguish between Irs1 S307A mutant (S7A) knockin and control knockin (CK) alleles. Note: this is an allele-specific PCR; a wt (+) allele, gives same bands as CK allele. Digest is not required. | ||||||||||
| Samples: | |||||||||||
| 1 | |||||||||||
| 2 | |||||||||||
| 3 | |||||||||||
| 4 | |||||||||||
| 5 | |||||||||||
| # of rxns | |||||||||||
| Reactions (ul): | X | 11 | Profile name: | JBM&S7A | |||||||
| DNA | 1 | step | time (min:sec) | temp (C) | |||||||
| H20 | 11.5 | 126.5 | 1 | 15:00 | 95 | ||||||
| 10X buffer | 2 | 22 | 2 | :30 | 94 | ||||||
| 4mM dNTPs | 1.5 | 16.5 | 3 | :20 | 64 | ||||||
| 10pmol/ul primers | 4 | :45 | 72 | ||||||||
| S7AF3 | 1 | 11 | go to | step 2 | 34 times | ||||||
| NBR | 1 | 11 | 5 | 10:00 | 72 | ||||||
| BF | 1 | 11 | 6 | hold | 4 | ||||||
| S7AR (1010) | 1 | 11 | |||||||||
| 20 | ul | 209 | ul | ||||||||
| + HotStar Taq | 0.18 | ul | 1.98 | ||||||||
| Primers: | Sequence: (5' to3') | Tm | |||||||||
| S7AF3 | GCAGCAAAAGCCAGTCTTCATCC | 59.0 | |||||||||
| NBR (not BamHI) | AGGCACGCACCCGGAAGGAG | 64.9 | |||||||||
| BF (BamHI) | AGTATGGTGGGTGGGAAACCAGGA | 61.9 | |||||||||
| S7AR (1010) | CTGGGGTGACACTGCGGAAGG | 62.7 | |||||||||
| Products: | from allele(s) | length (bp) | digests? | primers | |||||||
| common outer | all alleles | 542 | BamHI (S7A)* | S7AF3 + S7AR | |||||||
| spurious: | all alleles (occasionally) | ~280 | don't know origin of this band; disregard | ||||||||
| S7A-specific (A) | S7A | 399 | BF + S7AR | ||||||||
| wt-specific (S) | CK, +, etc | 185 | S7AF3 + NBR | ||||||||
| (* from the S7A allele only, the common band from outer | |||||||||||
| primers can be digested with BamHI) | |||||||||||
| Genotypes: | bands | ||||||||||
| +/+ | 542 (variable), 185 | ||||||||||
| CK/CK | 542 (variable), 185 | ||||||||||
| S7A/CK or S7A/+ | 542 (variable), 399, 185 | ||||||||||
| S7A/S7A | 542 (variable), 399 | ||||||||||