| Today's date: | 9/19/05 | ||||||||
| PCR name: | ix1 | ||||||||
| Purpose: | Genotype intercross progeny (ix) simultaneously for three Irs1 alleles: wt (+) allele, Irs1 knockout (ko) allele, Irs1 knockin mutant alleles (ki) with neo (n) cassette at 3' end of coding region (examples CKn, FCTn) | ||||||||
| Samples: | |||||||||
| 1 | |||||||||
| 2 | |||||||||
| 3 | |||||||||
| 4 | |||||||||
| 5 | |||||||||
| # of rxns | |||||||||
| Reactions (ul): | X | 13 | Profile name: | ix1 | |||||
| DNA | 1 | step | time (min:sec) | temp (C) | |||||
| H20 | 12.3 | 159.9 | 1 | 15:00 | 95 | ||||
| 10X buffer | 2 | 26 | 2 | :30 | 94 | ||||
| 4mM dNTPs | 1.5 | 19.5 | 3 | :20 | 60 | ||||
| 10pmol/ul primers | 4 | :45 | 72 | ||||||
| cdsN2 | 0.8 | 10.4 | go to | step 2 | 36 times | ||||
| E | 0.8 | 10.4 | 5 | 10:00 | 72 | ||||
| Irs1 neoF2 | 0.8 | 10.4 | 6 | hold | 4 | ||||
| Irs1 lower | 0.8 | 10.4 | |||||||
| 20 | ul | 247 | ul | ||||||
| + HotStar Taq | 0.18 | ul | 2.34 | ul | |||||
| Primers: | Sequence: (5' to3') | Tm | |||||||
| cdsN2 | GCAGTGAGGATGTAAAACGCCACAGCTCTGCATC | 66.0 | |||||||
| E | GGGGCCCTCGACATAACTTCGTATAGCATACAT | 63.3 | |||||||
| Irs1 neoF2 | GCATCGCCTTCTATCGCCTTCTTG | 60.0 | |||||||
| Irs1 lower | TGGCCGCTCCCGAATTCAAT (has bad 3' end) | 59.8 | |||||||
| Products: | from allele(s) | length (bp) | digests? | primers | |||||
| ko | 680 | Irs1 neoR2 + Irs1 lower | |||||||
| spurious: | FCTn, CKn, etc | ~650 | don't know origin of this band; disregard | ||||||
| CKn, FCTn, etc | 387 | cdsN2 + E | |||||||
| (to distinguish CKn and FCTn, do PCR A with BglII digest) | |||||||||
| Genotypes: | bands | Note: | if necessary, infer genotypes from parentage or… | ||||||
| +/+ | none | confirm with PCR A | |||||||
| FCT/+, CK/+ | 387 only | distinguish with PCR A digested with BglII | |||||||
| ko/+ | 680 only | confirm with PCR Irs1 | |||||||
| FCT/FCT, CK/CK | 387 only | distinguish with PCR A digested with BglII | |||||||
| FCT/ko, CK/ko | 680, 650 (faint), and 387 | distinguish with PCR A digested with BglII | |||||||
| ko/ko | 680 only | confirm with PCR Irs1 | |||||||