| Today's date: | 9/19/05 | ||||||||
| PCR name: | Irs1 | ||||||||
| Purpose: | Genotype for combination of two Irs1 alleles: wt (+) allele, or Irs1 knockout (ko) allele | ||||||||
| Samples: | |||||||||
| 1 | |||||||||
| 2 | |||||||||
| 3 | |||||||||
| 4 | |||||||||
| 5 | |||||||||
| # of rxns | |||||||||
| Reactions (ul): | X | 16 | Profile name: | Irs1 | |||||
| DNA | 1 | step | time (min:sec) | temp (C) | |||||
| H20 | 11.5 | 184 | 1 | 15:00 | 95 | ||||
| 10X buffer | 2 | 32 | 2 | :30 | 94 | ||||
| 4mM dNTPs | 1.5 | 24 | 3 | :20 | 60 | ||||
| 10pmol/ul primers | 4 | :45 | 72 | ||||||
| Irs1 upper | 0.5 | 8 | go to | step 2 | 39 times | ||||
| Irs1 lower | 1.5 | 24 | 5 | 10:00 | 72 | ||||
| Irs1 neoF2 | 2 | 32 | 6 | hold | 4 | ||||
| 20 | ul | 304 | ul | ||||||
| + HotStar Taq | 0.18 | ul | 2.88 | ul | |||||
| Primers: | Sequence: (5' to3') | Tm | |||||||
| Irs1 upper | GCCAGGCACCAGCATCTTCG | 13/20 GC 3 in 1st 7 | 61.5 | ||||||
| Irs1 lower | TGGCCGCTCCCGAATTCAAT (has bad 3' end) | 11/20 GC 1 in 1st 7 | 59.8 | ||||||
| Irs1 neoF2 | GCATCGCCTTCTATCGCCTTCTTG | 13/24 GC 3 in 1st 7 | 60.0 | ||||||
| Products: | from allele(s) | length (bp) | digests? | primers | |||||
| upper band | ko | 680 | Irs1 neoF2 + Irs1 lower | ||||||
| lower band | + | 360 | Irs1 upper + Irs1 lower | ||||||
| Genotypes: | bands | ||||||||
| +/+ | 360 only | ||||||||
| ko/+ | 360 and 680 | ||||||||
| ko/ko | 680 only | ||||||||