| Today's date: | 9/19/05 | ||||||||
| PCR name: | F (flox+) | ||||||||
| Purpose: | Diagnostic for IRS1 tissue specific knockout (TKO1) allele in floxed form. Works by amplifying region surrounding the loxP site in the Irs1 promoter region. | ||||||||
| Samples: | |||||||||
| 1 | |||||||||
| 2 | |||||||||
| 3 | |||||||||
| 4 | |||||||||
| 5 | |||||||||
| # of rxns | |||||||||
| Reactions (ul): | X | 21 | Profile name: | JBM&S7A | |||||
| DNA | 1 | step | time (min:sec) | temp (C) | |||||
| H20 | 13.5 | 283.5 | 1 | 15:00 | 95 | ||||
| 10X buffer | 2 | 42 | 2 | :30 | 94 | ||||
| 4mM dNTPs | 1.5 | 31.5 | 3 | :20 | 64 | ||||
| 10pmol/ul primers | 4 | :45 | 72 | ||||||
| Nhe7 | 1 | 21 | go to | step 2 | 34 times | ||||
| Nhe10 | 1 | 21 | 5 | 10:00 | 72 | ||||
| 6 | hold | 4 | |||||||
| 20 | ul | 399 | ul | ||||||
| + HotStar Taq | 0.18 | ul | 3.78 | ul | |||||
| Primers: | Sequence: (5' to3') | Tm | |||||||
| Nhe7 | GCTAATAGTGCCAGGTGTGAGATC | 58.6 | |||||||
| Nhe10 | GGACGCGGGTGACCTGCTAG | 63.0 | |||||||
| Products: | from allele(s) | length (bp) | digests? | primers | |||||
| flox | Irs1 flox | 322 | Nhe7 + Nhe10 | ||||||
| + | + | 278 | Nhe7 + Nhe10 | ||||||
| Genotype: | bands | ||||||||
| +/+ | 278 | ||||||||
| D13/+ | 278 | ||||||||
| D13/D13 | none | ||||||||
| flox/+ | 317, 278 | ||||||||
| flox/flox | 317 only | ||||||||