Today's date: |
9/19/05 |
|
|
|
|
|
|
|
|
PCR name: |
A* (A star) |
|
Purpose: |
Distinguishes between wt (+) allele and Irs1 knockin (ki) mutant
alleles FCT and CK when there is a possibility that these are present
together. Digest of the PCR with BglII reveals whether knockin allele is FCT
or control CK. |
|
Samples: |
|
1 |
|
2 |
|
3 |
|
4 |
|
5 |
|
|
|
# of rxns |
|
Reactions (ul): |
X |
11 |
|
Profile name: |
IRS1KIGT |
|
|
DNA |
1 |
|
|
|
step |
time (min:sec) |
temp (C) |
|
H20 |
13.5 |
|
148.5 |
|
1 |
15:00 |
95 |
|
10X buffer |
2 |
|
22 |
|
2 |
:30 |
94 |
|
4mM dNTPs |
1.5 |
|
16.5 |
|
3 |
:20 |
62 |
|
10pmol/ul primers |
|
4 |
:45 |
72 |
|
cdsN2 |
1 |
|
11 |
|
go to |
step 2 |
34 times |
|
UTRrev1 |
1 |
|
11 |
|
5 |
10:00 |
72 |
|
|
|
6 |
hold |
4 |
|
|
|
|
|
|
|
20 |
ul |
209 |
ul |
|
|
+ HotStar Taq |
0.18 |
ul |
1.98 |
ul |
|
|
Primers: |
Sequence: (5' to3') |
|
|
|
|
|
Tm |
|
cdsN2 |
GCAGTGAGGATGTAAAACGCCACAGCTCTGCATC |
|
66.0 |
|
UTRrev1 |
AGAGAGAAGCCCTTCTGTGGCTGCTCCAAACACA |
|
67.5 |
|
|
|
Products: |
from allele(s) |
|
length (bp) |
digests? |
|
primers |
|
|
|
+ |
wt (+) |
|
584 |
583 |
|
cdsN2 + UTRrev1 |
|
ki |
ki (CK, S7A, JBM, etc) |
649 |
|
cdsN2 + UTRrev1 |
|
ki |
ki (FCT) |
|
649 |
Bgl II |
|
cdsN2 + UTRrev1 |
|
|
(add 10 units BglII directly to 20
ul reaction) |
|
|
Genotype: |
bands (after digestion) |
|
|
|
|
|
|
|
+/+ |
584 only |
|
CK/+, S7A/+, etc |
649 and 584 |
|
FCT/+ |
584, 509 and 140 (faint) |
|
for FCT ki only, 649bp band digests
with BglII |
|
CK/CK |
649 |
|
FCT/CK |
649, 509 and 140 (faint) |
|
for FCT ki only, 649bp band digests
with BglII |
|
FCT/FCT |
509 and 140 (faint) only |
|
for FCT ki only, 649bp band digests
with BglII |
|
|
for FCT ki only, 649bp band digests
with BglII |
|
|
|
|
|
|
|
|
|
|
|