| Today's date: | 9/19/05 | ||||||||
| PCR name: | A* (A star) | ||||||||
| Purpose: | Distinguishes between wt (+) allele and Irs1 knockin (ki) mutant alleles FCT and CK when there is a possibility that these are present together. Digest of the PCR with BglII reveals whether knockin allele is FCT or control CK. | ||||||||
| Samples: | |||||||||
| 1 | |||||||||
| 2 | |||||||||
| 3 | |||||||||
| 4 | |||||||||
| 5 | |||||||||
| # of rxns | |||||||||
| Reactions (ul): | X | 11 | Profile name: | IRS1KIGT | |||||
| DNA | 1 | step | time (min:sec) | temp (C) | |||||
| H20 | 13.5 | 148.5 | 1 | 15:00 | 95 | ||||
| 10X buffer | 2 | 22 | 2 | :30 | 94 | ||||
| 4mM dNTPs | 1.5 | 16.5 | 3 | :20 | 62 | ||||
| 10pmol/ul primers | 4 | :45 | 72 | ||||||
| cdsN2 | 1 | 11 | go to | step 2 | 34 times | ||||
| UTRrev1 | 1 | 11 | 5 | 10:00 | 72 | ||||
| 6 | hold | 4 | |||||||
| 20 | ul | 209 | ul | ||||||
| + HotStar Taq | 0.18 | ul | 1.98 | ul | |||||
| Primers: | Sequence: (5' to3') | Tm | |||||||
| cdsN2 | GCAGTGAGGATGTAAAACGCCACAGCTCTGCATC | 66.0 | |||||||
| UTRrev1 | AGAGAGAAGCCCTTCTGTGGCTGCTCCAAACACA | 67.5 | |||||||
| Products: | from allele(s) | length (bp) | digests? | primers | |||||
| + | wt (+) | 584 | 583 | cdsN2 + UTRrev1 | |||||
| ki | ki (CK, S7A, JBM, etc) | 649 | cdsN2 + UTRrev1 | ||||||
| ki | ki (FCT) | 649 | Bgl II | cdsN2 + UTRrev1 | |||||
| (add 10 units BglII directly to 20 ul reaction) | |||||||||
| Genotype: | bands (after digestion) | ||||||||
| +/+ | 584 only | ||||||||
| CK/+, S7A/+, etc | 649 and 584 | ||||||||
| FCT/+ | 584, 509 and 140 (faint) | for FCT ki only, 649bp band digests with BglII | |||||||
| CK/CK | 649 | ||||||||
| FCT/CK | 649, 509 and 140 (faint) | for FCT ki only, 649bp band digests with BglII | |||||||
| FCT/FCT | 509 and 140 (faint) only | for FCT ki only, 649bp band digests with BglII | |||||||
| for FCT ki only, 649bp band digests with BglII | |||||||||