| Today's date: | 9/19/05 | ||||||||
| PCR name: | Cre (E) | ||||||||
| Purpose: | Determine presence of Cre transgene(s); does not distinguish between one copy or two | ||||||||
| Samples: | |||||||||
| 1 | |||||||||
| 2 | |||||||||
| 3 | |||||||||
| 4 | |||||||||
| 5 | |||||||||
| # of rxns | |||||||||
| Reactions (ul): | X | 4 | Profile name: | Cre (E) | |||||
| DNA | 1 | step | time (min:sec) | temp (C) | |||||
| H20 | 13.5 | 54 | 1 | 15:00 | 95 | ||||
| 10X buffer | 2 | 8 | 2 | :30 | 94 | ||||
| 4mM dNTPs | 1.5 | 6 | 3 | :20 | 60 | ||||
| 10pmol/ul primers | 4 | :45 | 72 | ||||||
| 567 | 0.5 | 2 | go to | step 2 | 36 times | ||||
| 568 | 0.5 | 2 | 5 | 10:00 | 72 | ||||
| (control) 42 | 0.5 | 2 | 6 | hold | 4 | ||||
| (control) 43 | 0.5 | 2 | |||||||
| 20 | ul | 76 | ul | ||||||
| + HotStar Taq | 0.18 | ul | 0.72 | ul | |||||
| Primers: | Sequence: (5' to3') | Tm | |||||||
| 567 | ACCAGCCAGCTATCAACTCG | 58.0 | |||||||
| 568 | TTACATTGGTCCAGCCACC | 55.8 | |||||||
| (control) 42 | CTAGGCCACAGAATTGAAAGATCT | 56.3 | |||||||
| (control) 43 | GTAGGTGGAAATTCTAGCATCATCC | 56.8 | |||||||
| Products: | from allele(s) | length (bp) | digests? | primers | |||||
| internal control | all | 325 | 42 + 43 | ||||||
| Cre Tg | Cre | 200 | 567 + 568 | ||||||
| Genotypes: | bands | ||||||||
| +/+ | 325 | ||||||||
| Cre/+ | 325, 200 | ||||||||
| Cre/Cre | 325, 200 | ||||||||