Today's date: | 9/19/05 | ||||||||
PCR name: | Cre (E) | ||||||||
Purpose: | Determine presence of Cre transgene(s); does not distinguish between one copy or two | ||||||||
Samples: | |||||||||
1 | |||||||||
2 | |||||||||
3 | |||||||||
4 | |||||||||
5 | |||||||||
# of rxns | |||||||||
Reactions (ul): | X | 4 | Profile name: | Cre (E) | |||||
DNA | 1 | step | time (min:sec) | temp (C) | |||||
H20 | 13.5 | 54 | 1 | 15:00 | 95 | ||||
10X buffer | 2 | 8 | 2 | :30 | 94 | ||||
4mM dNTPs | 1.5 | 6 | 3 | :20 | 60 | ||||
10pmol/ul primers | 4 | :45 | 72 | ||||||
567 | 0.5 | 2 | go to | step 2 | 36 times | ||||
568 | 0.5 | 2 | 5 | 10:00 | 72 | ||||
(control) 42 | 0.5 | 2 | 6 | hold | 4 | ||||
(control) 43 | 0.5 | 2 | |||||||
20 | ul | 76 | ul | ||||||
+ HotStar Taq | 0.18 | ul | 0.72 | ul | |||||
Primers: | Sequence: (5' to3') | Tm | |||||||
567 | ACCAGCCAGCTATCAACTCG | 58.0 | |||||||
568 | TTACATTGGTCCAGCCACC | 55.8 | |||||||
(control) 42 | CTAGGCCACAGAATTGAAAGATCT | 56.3 | |||||||
(control) 43 | GTAGGTGGAAATTCTAGCATCATCC | 56.8 | |||||||
Products: | from allele(s) | length (bp) | digests? | primers | |||||
internal control | all | 325 | 42 + 43 | ||||||
Cre Tg | Cre | 200 | 567 + 568 | ||||||
Genotypes: | bands | ||||||||
+/+ | 325 | ||||||||
Cre/+ | 325, 200 | ||||||||
Cre/Cre | 325, 200 | ||||||||