| Today's date: | 9/19/05 | ||||||||
| PCR name: | B | ||||||||
| Purpose: | Distinguishes between wt (+) allele and Irs1 knockin mutant alleles (ki) that no longer have neo cassette at 3' end, but do have a single loxP site and other extra sequence there (66 bp total). Examples include CK, FCT, S7A, JBM segregating with + allele. | ||||||||
| Samples: | |||||||||
| 1 | |||||||||
| 2 | |||||||||
| 3 | |||||||||
| 4 | |||||||||
| 5 | |||||||||
| # of rxns | |||||||||
| Reactions (ul): | X | 33 | Profile name: | IRS1KIGT | |||||
| DNA | 1 | step | time (min:sec) | temp (C) | |||||
| H20 | 13.5 | 445.5 | 1 | 15:00 | 95 | ||||
| 10X buffer | 2 | 66 | 2 | :30 | 94 | ||||
| 4mM dNTPs | 1.5 | 49.5 | 3 | :20 | 62 | ||||
| 10pmol/ul primers | 4 | :45 | 72 | ||||||
| cdsC2 | 1 | 33 | go to | step 2 | 34 times | ||||
| UTRrev1 | 1 | 33 | 5 | 10:00 | 72 | ||||
| 6 | hold | 4 | |||||||
| 20 | ul | 627 | ul | ||||||
| + HotStar Taq | 0.18 | ul | 5.94 | ul | |||||
| Primers: | Sequence: (5' to3') | Tm | |||||||
| cdsC2 | CAGCAATGAGGGCAACTCCCCAAGACGCTCCA | 71.7 | |||||||
| UTRrev1 | AGAGAGAAGCCCTTCTGTGGCTGCTCCAAACACA | 67.5 | |||||||
| Products: | from allele(s) | length (bp) | digests? | primers | |||||
| + | wt (+) | 423 | cdsC2 + UTRrev1 | ||||||
| ki | ki (CK, FCT, S7A, etc) | 358 | cdsC2 + UTRrev1 | ||||||
| Genotype: | bands | ||||||||
| +/+ | 358 only | ||||||||
| CK/+, FCT/+, etc | 423 and 358 | ||||||||
| FCT/FCT, CK/CK | 423 only | ||||||||