Today's date: | 9/19/05 | ||||||||
PCR name: | B | ||||||||
Purpose: | Distinguishes between wt (+) allele and Irs1 knockin mutant alleles (ki) that no longer have neo cassette at 3' end, but do have a single loxP site and other extra sequence there (66 bp total). Examples include CK, FCT, S7A, JBM segregating with + allele. | ||||||||
Samples: | |||||||||
1 | |||||||||
2 | |||||||||
3 | |||||||||
4 | |||||||||
5 | |||||||||
# of rxns | |||||||||
Reactions (ul): | X | 33 | Profile name: | IRS1KIGT | |||||
DNA | 1 | step | time (min:sec) | temp (C) | |||||
H20 | 13.5 | 445.5 | 1 | 15:00 | 95 | ||||
10X buffer | 2 | 66 | 2 | :30 | 94 | ||||
4mM dNTPs | 1.5 | 49.5 | 3 | :20 | 62 | ||||
10pmol/ul primers | 4 | :45 | 72 | ||||||
cdsC2 | 1 | 33 | go to | step 2 | 34 times | ||||
UTRrev1 | 1 | 33 | 5 | 10:00 | 72 | ||||
6 | hold | 4 | |||||||
20 | ul | 627 | ul | ||||||
+ HotStar Taq | 0.18 | ul | 5.94 | ul | |||||
Primers: | Sequence: (5' to3') | Tm | |||||||
cdsC2 | CAGCAATGAGGGCAACTCCCCAAGACGCTCCA | 71.7 | |||||||
UTRrev1 | AGAGAGAAGCCCTTCTGTGGCTGCTCCAAACACA | 67.5 | |||||||
Products: | from allele(s) | length (bp) | digests? | primers | |||||
+ | wt (+) | 423 | cdsC2 + UTRrev1 | ||||||
ki | ki (CK, FCT, S7A, etc) | 358 | cdsC2 + UTRrev1 | ||||||
Genotype: | bands | ||||||||
+/+ | 358 only | ||||||||
CK/+, FCT/+, etc | 423 and 358 | ||||||||
FCT/FCT, CK/CK | 423 only | ||||||||