Today's date: | 9/19/05 | ||||||||
PCR name: | A | ||||||||
Purpose: | Distinguishes between wt (+) allele and Irs1 knockin mutant
alleles (ki) still containing neo (n) cassette at 3' end of coding region
(examples: CKn, FCTn, S7An, JBMn). Digest of this PCR with BglII is also useful for distinguishing between CKn and FCTn alleles. |
||||||||
Samples: | |||||||||
1 | |||||||||
2 | |||||||||
3 | |||||||||
4 | |||||||||
5 | |||||||||
# of rxns | |||||||||
Reactions (ul): | X | 13 | Profile name: | IRS1KIGT | |||||
DNA | 1 | step | time (min:sec) | temp (C) | |||||
H20 | 13 | 169 | 1 | 15:00 | 95 | ||||
10X buffer | 2 | 26 | 2 | :30 | 94 | ||||
4mM dNTPs | 1.5 | 19.5 | 3 | :20 | 62 | ||||
10pmol/ul primers | 4 | :45 | 72 | ||||||
cdsN2 | 1 | 13 | go to | step 2 | 34 times | ||||
E | 0.5 | 6.5 | 5 | 10:00 | 72 | ||||
UTRrev1 | 1 | 13 | 6 | hold | 4 | ||||
20 | ul | 247 | ul | ||||||
+ HotStar Taq | 0.18 | ul | 2.34 | ul | |||||
Primers: | Sequence: (5' to3') | Tm | |||||||
cdsN2 | GCAGTGAGGATGTAAAACGCCACAGCTCTGCATC | 66.0 | |||||||
E | GGGGCCCTCGACATAACTTCGTATAGCATACAT | 63.3 | |||||||
UTRrev1 | AGAGAGAAGCCCTTCTGTGGCTGCTCCAAACACA | 67.5 | |||||||
Products: | from allele(s) | length (bp) | digests? | primers | |||||
+ | wt (+) | 584 | no | cdsN2 + UTRrev1 | |||||
ki | ki (CKn, S7An, etc) | 387 | no | cdsN2 + E | |||||
ki | ki (FCTn) | 387 | yes, Bgl II | cdsN2 + E | |||||
(can add 10 units Bgl II directly to 20 ul reaction) | |||||||||
Genotype: | bands | ||||||||
+/+ | 584 only | ||||||||
CKn/+,S7An/+, etc | 584 and 387 | ||||||||
FCTn/+ | 584 and 387 | ||||||||
FCTn/CKn, etc | 584 only | ||||||||
bands | after OPTIONAL digest with Bgl II (useful as compliment to PCR ix) | ||||||||
CKn/+ | 584, 387 | ||||||||
CKn/ko | 584, 387 | ie ko gives same 584 bp band as + allele | |||||||
FCTn/+ | 584, 247 and 140 | for FCT ki only: 387 bp digests into 140 bp + 247 bp | |||||||
FCTn/CKn | 399, 247 and 140 | for FCT ki only: 387 bp digests into 140 bp + 247 bp |