| Today's date: | 9/19/05 | ||||||||
| PCR name: | DG | ||||||||
| Purpose: | Distinguish between Ptpn11 (ie Shp2) dominant active (D61G) mutant allele and wt (+) allele. This an allele specific PCR. Digest is not necessary. | ||||||||
| Samples: | |||||||||
| 1 | |||||||||
| 2 | |||||||||
| 3 | |||||||||
| 4 | |||||||||
| 5 | |||||||||
| # of rxns | |||||||||
| Reactions (ul): | X | 13 | Profile name: | DG | |||||
| DNA | 1 | step | time (min:sec) | temp (C) | |||||
| H20 | 11.5 | 149.5 | 1 | 15:00 | 95 | ||||
| 10X buffer | 2 | 26 | 2 | :30 | 94 | ||||
| 4mM dNTPs | 1.5 | 19.5 | 3 | :20 | 62 | ||||
| 10pmol/ul primers | 4 | :45 | 72 | ||||||
| DOF | 1 | 13 | go to | step 2 | 34 times | ||||
| DR1 | 1 | 13 | 5 | 10:00 | 72 | ||||
| GF1 | 1 | 13 | 6 | hold | 4 | ||||
| GOR | 1 | 13 | |||||||
| 20 | ul | 247 | ul | ||||||
| + HotStar Taq | 0.18 | ul | 2.34 | ||||||
| Primers: | Sequence: (5' to3') | Tm | |||||||
| DOF (D outer) | GCCAGCCATTCAAAGTAGAATCTC | 56.0 | |||||||
| DR1 | CATAGAGGTCATAGTAGTCCCCA | 54.8 | |||||||
| GF1 | CATCAAGATTCAGAACACCGGTGG | 57.9 | |||||||
| GOR (G outer) | ACCTGGTCACGAAGATGTCACTGA | 59.8 | |||||||
| Products: | from allele(s) | length (bp) | digests? | primers | |||||
| common outer | all alleles | 429 | AgeI (DG)* | DOF + GOR | |||||
| wt-specific (D) | + | 270 | DOF + DR1 | ||||||
| mutant-specific (G) | DG | 198 | GF1 + GOR | ||||||
| (* from the DG allele only, the common band from outer | |||||||||
| primers can be digested with AgeI.) | |||||||||
| Genotypes: | bands | ||||||||
| +/+ | 429 (variable), 270 | ||||||||
| DG/+ | 429 (variable), 270, 198 | ||||||||
| DG/DG | 429 (variable), 198 | ||||||||